Invitrogen gateway cloning manual
· Choosing Products to Build GATEWAY™ Expression Clones Step 1: Construct or Select an Entry Clone starting from: PCR Fragment Restriction Fragment Library Screening Design primers with attB sites Choose Entry Vector Isolate clone from pCMV•SPORT Amplify PCR product Individual Entry Vectors 6; pSPORT-P; or pEXP-AD Cat. Nos. ; library ; ; . containing expression clone. Store Gateway™ LR Clonase™ II enzyme mix at –20°C (non-frost-free freezer) for up to 6 months. For long-term storage, store at –80°C. Gateway™ technology Gateway™ Technology is a universal cloning method that takes advantage of the site-File Size: KB. The easy-to-use choice for everyday cloning. Invitrogen Gateway recombination cloning technology circumvents traditional restriction enzyme based cloning limitations, enabling you to access virtually any expression system in just a few simple steps.
The easy-to-use choice for everyday cloning. Invitrogen Gateway recombination cloning technology circumvents traditional restriction enzyme based cloning limitations, enabling you to access virtually any expression system in just a few simple steps. Choosing Products to Build GATEWAY™ Expression Clones Step 1: Construct or Select an Entry Clone starting from: PCR Fragment Restriction Fragment Library Screening Design primers with attB sites Choose Entry Vector Isolate clone from pCMV•SPORT Amplify PCR product Individual Entry Vectors 6; pSPORT-P; or pEXP-AD Cat. Nos. ; library ; ; ; See Catalog or web site for list of GATEWAY Libraries and Custom Libraries Clone attB-PCR product into. Gateway ® destination vector of choice to generate an expression clone which may then be used in the appropriate application or expression system. 4. Convert your own vector to a destination vector. For details about a particular Life Technologies destination vector or expression system, refer to the manual for the specific destination vector.
Traditionally, gene cloning has relied on restriction enzyme digestion and ligation. In recent years, however, Gateway® cloning technology (Invitrogen Co.) has. 12 thg 1, The Gateway cloning method, developed by Invitrogen, is an in vitro version of the integration and excision recombination reactions that take. Introduction · Add four 5′ guanine (G) nucleotides · Add the specified att motif to your primers · End the attB1 with a T “ACAAGTTTGTACAAAAAAGCAGGCT“ · Add a 2.