Ambion megascript t7 kit manual
· Template size The MEGAshortscript Kit is designed to function best with templates that code for RNA transcripts in the 20 to nt range. The kit can be used to produce longer RNA but the Ambion MEGAscript Kit is more economical for this purpose. Template input The amount of template needed will depend on the amount of product. The T7 Enzyme Mix and the 10X Reaction Buffer are specifically calibrated for each lot and RNA polymerase. Using the MEGAscript T7 Kit: The MEGAscript T7 Kit contains in vitro transcription reaction components and a control template. The kit will yield a total of 3 to 5mg of RNA (approximately μg of RNA or more per reaction) from the control template supplied with the kit. The MEGAscript® T7 Kit is intended for the synthesis of large amounts of unlabeled or low specific activity RNA for a variety of uses, including in vitro translation, antisense/microinjection studies, and isolation of RNA binding www.doorway.ru: Invitrogen™.
T7 promoter sequences can be added to DNA using PCR to generate templates that can be directly added to the MEGAscript RNAi Kit tran-scription reaction. Begin by synthesizing PCR primers with the T7 pro-moter sequence appended to the 5' end of the primer. The T7 promoter-containing PCR primers (sense and antisense) can either be. with the kit The MEGAscript ® Kit should be stored in a non-fros t-free freezer. Keep all reagents on ice while using the kit; the nucleotides and enzymes are especially labile. Components specific to the RNA polymerase in the kit The SP6, T7, or T3 Enzyme Mix and the 10X Reaction Buffer are specifically calibrated for each lot and RNA polymerase. The MEGAscript T7 Kit contains in vitro transcription reaction components and a control template. The kit will yield a total of 3 to 5mg of RNA (approximately μg of RNA or more per reaction) from the control template supplied with the kit. This corresponds to to moles of RNA for each mole of template.
www.doorway.ruals not Provided with the Kit. E. Related Products Available from Ambion. II. mMESSAGE mMACHINE™ Protocol. 4. A. Template DNA. MEGAscript T7 in vitro transcription kit was from Ambion (Austin, TX). in vitro transcription system according to the manufacturer's instructions. Add T7 overhangs to working primers (5′ TAATACGACTCACTATAGGGAGA 3′). Materials. MegaScript RNAi kit (Ambion AM); Eliminase. Adding T7 sites and scaling up.