Ameba Ownd

アプリで簡単、無料ホームページ作成

rearthlasihas1975's Ownd

What is the difference between antibodies and b cell receptor

2022.01.06 17:48




















B cell receptor and antibody are two types of molecules that relate to B cells. The B cells are one of the two types of lymphocytes that the the bone marrow produce. What is an Antibody — Definition, Structure, Role 3. B cell receptor BCR is a type of receptor molecule that we can find on the surface of the B cells. T helper cells induce B cells to proliferate and produce specific antibodies against a particular pathogen. Furthermore, a clone of B cells produces only one type of antibodies. A typical B cell may contain around 10 5 of such antibodies.


Moreover, the initial antibodies produced by the B cells are not secreted to the circulation but are inserted into the cell membrane to serve as BCRs. The antibodies that are not secreted into the circulation are called immunoglobulins.


Hence, BCRs are such immunoglobulins on the surface of the B cells. The binding of a specific antigen causes the activation of the B cell receptor. This initiates a cascade of intracellular signalling, which leads to the internalization of the antigen-bound BCR for the processing and presenting the antigen to the T cells. Song S, Matthias PD. The transcriptional regulation of germinal center formation. Front Immunol. Antigen recognition strength regulates the choice between extrafollicular plasma cell and germinal center B cell differentiation.


Germinal Center B Cell Dynamics. The extent of affinity maturation differs between the memory and antibody-forming cell compartments in the primary immune response.


EMBO J. High affinity germinal center B cells are actively selected into the plasma cell compartment. T-cell receptor signaling to integrins. Germinal center dynamics revealed by multiphoton microscopy with a photoactivatable fluorescent reporter. T follicular helper cell-germinal center B cell interaction strength regulates entry into plasma cell or recycling germinal center cell fate.


IL regulates germinal center B cell differentiation and proliferation through a B cell-intrinsic mechanism. The transcriptional programme of antibody class switching involves the repressor Bach2. Proapoptotic BH3-only protein Bim is essential for developmentally programmed death of germinal center-derived memory B cells and antibody-forming cells.


Architecture and dynamics of the transcription factor network that regulates B-to-plasma cell differentiation. J Biochem. Regulation of memory B-cell survival by the BH3-only protein Puma.


Intrinsic differences in the proliferation of naive and memory human B cells as a mechanism for enhanced secondary immune responses. Memory B cells, but not long-lived plasma cells, possess antigen specificities for viral escape mutants. Unique maturation program of the IgE response in vivo. Premature replacement of mu with alpha immunoglobulin chains impairs lymphopoiesis and mucosal homing but promotes plasma cell maturation.


No receptor stands alone: IgG B-cell receptor intrinsic and extrinsic mechanisms contribute to antibody memory. Cell Res. Independent roles of switching and hypermutation in the development and persistence of B lymphocyte memory. CCR6-dependent positioning of memory B cells is essential for their ability to mount a recall response to antigen. CCR6 defines memory B cell precursors in mouse and human germinal centers, revealing light-zone location and predominant low antigen affinity.


The Eph-related tyrosine kinase ligand Ephrin-B1 marks germinal center and memory precursor B cells. J Allergy Clin Immunol. Germinal-center development of memory B cells driven by IL-9 from follicular helper T cells. IL-9 receptor signaling in memory B cells regulates humoral recall responses.


New markers for murine memory B cells that define mutated and unmutated subsets. The human spleen is a major reservoir for long-lived vaccinia virus-specific memory B cells. Memory B cells: effectors of long-lived immune responses. Memory B cells are reactivated in subcapsular proliferative foci of lymph nodes. Nat Commun. B cells acquire particulate antigen in a macrophage-rich area at the boundary between the Follicle and the subcapsular sinus of the Lymph Node.


Immune complex relay by subcapsular sinus macrophages and noncognate B cells drives antibody affinity maturation. Vajdy M, Lycke N. Stimulation of antigen-specific T- and B-cell memory in local as well as systemic lymphoid tissues following oral immunization with cholera toxin adjuvant. Memory B cells from human tonsils colonize mucosal epithelium and directly present antigen to T cells by rapid up-regulation of B and B Sequence analysis of rearranged IgVH genes from microdissected human Peyer's patch marginal zone B cells.


Diversification of memory B cells drives the continuous adaptation of secretory antibodies to gut microbiota. Limited clonal relatedness between gut IgA plasma cells and memory B cells after oral immunization. Human memory B cells in healthy gingiva, gingivitis, and periodontitis.


Broad dispersion and lung localization of virus-specific memory B cells induced by influenza pneumonia. Memory B cells in the lung participate in protective humoral immune responses to pulmonary influenza virus reinfection. The establishment of resident memory B cells in the lung requires local antigen encounter.


Distinct germinal center selection at local sites shapes memory B cell response to viral escape. Molecular analysis of clonal stability and longevity in B cell memory. The heterogeneity shown by human plasma cells from tonsil, blood, and bone marrow reveals graded stages of increasing maturity, but local profiles of adhesion molecule expression. Broadly cross-reactive antibodies dominate the human B cell response against pandemic H1N1 influenza virus infection.


Human Ebola virus infection results in substantial immune activation. Influenza infection in humans induces broadly cross-reactive and protective neuraminidase-reactive antibodies.


Chu VT, Berek C. The establishment of the plasma cell survival niche in the bone marrow. J Leukoc Biol. Generation of migratory antigen-specific plasma blasts and mobilization of resident plasma cells in a secondary immune response. Blood -borne human plasma cells in steady state are derived from mucosal immune responses.


Factors of the bone marrow microniche that support human plasma cell survival and immunoglobulin secretion.


BCMA is essential for the survival of long-lived bone marrow plasma cells. A coordinated change in chemokine responsiveness guides plasma cell movements. Cutting edge: profile of chemokine receptor expression on human plasma cells accounts for their efficient recruitment to target tissues. VLAfibronectin interaction is required for the terminal differentiation of human bone marrow cells capable of spontaneous and high rate immunoglobulin secretion.


The effect of mesenchymal stem cells on the viability, proliferation and differentiation of B-lymphocytes. Bone marrow mesenchymal stem cells enhance the differentiation of human switched memory B lymphocytes into plasma cells in serum-free medium. J Immunol Res. APRIL is critical for plasmablast survival in the bone marrow and poorly expressed by early-life bone marrow stromal cells. Extracellular vesicles from bone marrow-derived mesenchymal stromal cells support ex vivo survival of human antibody secreting cells.


J Extracell Vesicles. A unique population of IgG-expressing plasma cells lacking CD19 is enriched in human bone marrow. Early emergence of CDnegative human antibody-secreting cells at the plasmablast to plasma cell transition. The effects of microenvironment and internal programming on plasma cell survival. Int Immunol. Identification of a new subset of lymph node stromal cells involved in regulating plasma cell homeostasis. Human secretory IgM emerges from plasma cells clonally related to gut memory B cells and targets highly diverse commensals.


B-lymphocyte lineage cells and the respiratory system. Bunker JJ, Bendelac A. IgA Responses to Microbiota. Five human mature B cell subsets. Adv Exp Med Biol. Analysis of somatic mutation in five B cell subsets of human tonsil. Liu YJ, Arpin C. Germinal center development. Tissue distribution and dependence of responsiveness of human antigen-specific memory B cells. Discriminating gene expression profiles of memory B cell subpopulations.


Kuppers R. Human memory B cells: memory B cells of a special kind. Immunol Cell Biol. Evidence for a large compartment of IgM-expressing memory B cells in humans. Paramithiotis E, Cooper MD. Memory B lymphocytes migrate to bone marrow in humans. Adult bone marrow three-dimensional phenotypic landscape of B-cell differentiation.


Timens W, Poppema S. Lymphocyte compartments in human spleen. If this is the case, blocking the IgM receptor could become a new kind of treatment for certain autoimmune diseases. Early in development, B cells randomly rearrange their immunoglobulin genes through VDJ recombination and encounter a series of tolerance checkpoints that serve to remove autoreactive B cell receptors BCRs from the repertoire.


Yet, despite stringent counter-selection of autoreactivity, the mature follicular Fo B cell compartment retains cells reactive towards endogenous antigens Wardemann et al.


How these cells are restrained from mounting autoimmune responses is not fully understood. These results corroborate observations with several BCR transgenic model systems Cambier et al. However, whether or how IgM downregulation might constrain autoreactivity remains unclear because naturally-occurring autoreactive B cells maintain high expression of the IgD BCR isotype Zikherman et al. However, the expression pattern of the isotypes differs; IgM expression begins as soon as heavy and light chains recombine early in B cell development, and persists until class switch recombination occurs following B cell activation Chen and Cerutti, Initial characterization of IgM- and IgD-deficient mice revealed only mild phenotypes and substantial redundancy; each isotype could mediate B cell development, initiate antibody responses to T-dependent and -independent immunization, and induce normal levels of steady-state serum IgG Lutz et al.


This is consistent with prior studies in BCR transgenic model systems demonstrating that each isotype alone can mediate B cell development, deletion, and activation Brink et al. Therefore, it remains unclear whether IgM and IgD BCRs expressed in an unrestricted B cell repertoire differentially sense bona fide endogenous antigens in vivo, particularly as the identity and nature of such antigens is largely unknown and not restricted to soluble monovalent antigens.


We and others previously hypothesized that downregulation of IgM on Fo B cells might serve to restrain their response to endogenous antigen. Using this reporter of antigen-dependent signaling, we show that IgD is less sensitive than IgM to bona fide endogenous antigens in vivo despite higher surface expression and robust responsiveness to receptor ligation in vitro.


To further support these observations, we examine a series of cell fate decisions for which in vivo BCR signaling requirements have been previously defined. We show that IgD drives a pattern of development consistent with reduced endogenous antigen recognition, favoring MZ B cell fate and disfavoring B1a cell fate. Our data suggest that reduced endogenous antigen sensing i. We propose that predominant IgD expression maintains the quiescence of autoreactive B cells in response to chronic endogenous antigen stimulation, and limits autoantibody secretion in the context of rapid immune responses.


We previously showed that antigen recognition was both necessary and sufficient for NureGFP reporter expression by B cells in vivo Figure 1A Zikherman et al. Thus, reporter expression reflects endogenous antigen recognition in vivo. Conversely, under steady-state conditions in vivo, the NureGFP reporter does not reflect signaling through other receptors expressed in B cells; indeed, loss of either CD40, or TLR3, 7, and 9 signaling has no effect on reporter expression in B cells in vivo Figure 1—figure supplement 1A.


TLRs 1, 2, 4, 6, and the TLRlike molecule RP , we studied mice raised under either germ-free conditions or conventional specific-pathogen-free conditions.


We observed no induction of endogenous Nur77 protein in splenic B cells or endogenous Nr4a1 transcript in splenocytes in the presence of commensal flora Figure 1—figure supplement 1D,E.


Moreover, MyDdeficient and MyDsufficient splenocytes and peritoneal B1a cells express comparable amounts of endogenous Nr4a1 transcript and protein respectively under steady state conditions Figure 1—figure supplement 1F,G. Taken together, these data demonstrate that NureGFP expression in B cells under steady-state conditions in vivo is a specific readout of antigen-dependent signaling through the BCR Table 1. We therefore sought to take advantage of the NureGFP reporter in order to probe the responsiveness of a diverse BCR repertoire of mature B cells expressing either IgM or IgD alone to the vast range of endogenous antigens they may encounter in vivo.


Numerical data corresponding to endogenous Nur77 in germ-free mice depicted in Figure 1—figure supplement 1D. Numerical data corresponding to Nr4a1 transcript in germ-free mice depicted in Figure 1—figure supplement 1E.


Numerical data corresponding to endogenous Nur77 in MyDconditional-knockout peritoneal B1a cells in Figure 1—figure supplement 1F. Numerical data corresponding to Nr4a1 transcript in MyDconditional-knockout splenocytes in Figure 1—figure supplement 1G. Numerical data corresponding to receptor levels in Figure 1D.


The variation in surface IgM expression across the B cell repertoire is profound, spanning a fold range. Numerical data corresponding to activation marker upregulation in Figure 2E—H. Numerical data corresponding to basal calcium in Figure 2I. Numerical data corresponding to S6 phosphorylation in Figure 2—figure supplement 1A.


This discrepancy suggests that despite increased receptor expression and efficient coupling to downstream signaling machinery, residual endogenous antigens occupying the IgD BCR are less efficient at inducing signaling ex vivo. Consistent with this hypothesis, basal calcium analyzed immediately ex vivo is depressed in cells that express only IgD Figure 2I.


These data suggest that while signal transduction downstream of the IgD BCR is robust in vitro, IgD responds less efficiently than IgM to the relevant antigens it encounters in vivo. We further speculated that compensatory mechanisms such as altered surface receptor and altered BCR repertoire might fine tune how much signaling Fo B cells experience in vivo in order to lie within this range. To determine whether this difference was due to isotype or altered BCR repertoire, we probed GFP expression in B1a cells specific for phosphatidylcholine PtC , an endogenous antigen exposed on the surface of dying cells that is thought to select developing B cells into the B1a compartment Baumgarth, This was not explained by differences in surface receptor levels between these populations as they are comparable on this genetic background Figure 3—figure supplement 1A.


We exploited this property to confirm that the NureGFP difference in the MZ and B1a compartments is cell intrinsic and not a consequence of the presence or absence of serum IgM Figure 3—figure supplement 1B. Although IgD-only B cells can partially populate the B1a compartment in the absence of competition Lutz et al. Results include data from B for reference. Results include data from D for reference. Numerical data corresponding to splenic and peritoneal B cell compartment sizes in Figure 4—figure supplement 1B—C.


Further, the competitive advantage of IgD-only cells in the marginal zone niche is reduced by BAFF over-expression, consistent with loosening of competitive selection pressures Figure 4F. This may reflect impaired positive selection or survival in absence of IgD. However, endogenous antigens may have unique properties that are absent in model antigen systems. Secreted natural IgM is thought to play important homeostatic functions that repress autoimmunity, particularly clearance of dead cell debris Boes et al.


This implies that both BCRs can provide sufficient signals to drive polyclonal activation by endogenous antigens. Each color represents a single mouse tracked over time. Qualitatively similar results were obtained in two independent experiments. Numerical data corresponding to germinal center composition in Figure 5B.


Numerical data corresponding to autoantibody production in Figure 5C—G. Numerical data corresponding to germinal center composition in Figure 5—figure supplement 3B-C. Numerical data corresponding to autoantibody production in Figure 5—figure supplement 3D—E. This further implies that antigen capture by IgD and presentation on MHC-II is robust enough to recruit adequate T cell help to support these cell fates. IgG2a[a] vs. IgG2a[b] — also referred to as IgG2c. Allotype-specific antibodies have been previously used in the context of lupus mouse models to track autoantibodies generated by B cells of distinct genetic origin Mills et al.


Anti-dsDNA IgG autoantibodies in patients with systemic lupus erythematosus SLE similarly fluctuate over time — in contrast to other anti-nuclear specificities - and correlate with disease flares Liu et al. A pathway involving Btk, Ets1, and Blimp-1 is thought to drive this phenotype.


Ets1 inhibits plasma cell differentiation in part by antagonizing the key transcriptional regulator of plasma cell fate, Blimp-1 John et al. However, Lyn-deficient B cells expressing only IgD did not do so, consistent with a reduced ability of IgD to transmit antigen-dependent signals in vivo Figure 6A. C Percentages in B multiplied by the fraction of live cells positive for CD in each tissue.


Unswitched cells are positive for either IgM or IgD. D Serum IgM in week-old mice was quantified for B6. A sample from a WT mouse is shown for reference. Numerical data corresponding to Ets1 expression in Figure 6A. Numerical data corresponding to plasma cell compartments in Figure 6B—C.


Numerical data corresponding to serum IgM titers in Figure 6D. Numerical data corresponding to serum IgD titers in Figure 6E. Numerical data corresponding to Ets1 expression in splenic B cells in Figure 6A.


To generate a robust polyclonal B cell response in which T cell help should not be limiting, we used the classic immunogen sheep RBCs. C Splenocytes from mice in A. Numerical data corresponding to germinal center and plasma cell responses in Figure 7B-I , Figure 7—figure supplement 1A—D. Numerical data corresponding to germinal center and plasma cell responses in Figure 7B-I , Figure 7—figure supplement 1A—B.


Numerical data corresponding to unswitched plasma cell responses in Figure 7—figure supplement 1C—D. We could track the relative contribution of these two cell populations to the GC response because the bulk of GC B cells have not yet isotype-switched and express surface IgM or IgD.


Both cell types made a robust contribution to the germinal center response Figure 7E. Moreover, MZ B cells efficiently generate short-lived unswitched plasma cells even in response to TD-antigens Phan et al.


However, we cannot exclude a contribution of follicular-derived PCs that have failed to class switch to IgG1. These data suggest that IgD-only follicular B cells are competent to enter the GC, but they have defects in adopting the SLPC fate or class-switching in response to T-dependent immunization. We and others previously hypothesized that a major tolerance strategy employed by autoreactive Fo B cells is selective downregulation of IgM.


However, since all Fo B cells express a high and invariant amount of surface IgD, it was unclear whether and how loss of IgM expression could affect B cell responses to antigenic stimulation.


This could account for selective quiescence of mildly autoreactive B cells to monovalent endogenous antigens. Moreover, recent work from Goodnow and colleagues showed that HEL-specific IgD BCR, when expressed on primary mouse splenocytes, can indeed mobilize calcium in vitro and can mediate gene expression changes in vivo in response to monovalent cognate antigen Sabouri et al. How do our observations help move beyond and reconcile the seemingly contradictory published work on antigen sensing by IgM and IgD?


In vitro signaling studies of HEL-specific BCRs by the Jumaa and Goodnow labs differ in several important ways; the former work assesses calcium signaling in pre-B cells that lack Slp expression, while the latter studies splenic B cells with a considerably more mature phenotype. In addition, differences in reagents or strength of stimulus may also contribute to opposing conclusions.


Our data suggests that the reduced sensitivity of IgD to bona fide endogenous antigen may lie somewhere between these two extremes; we find that IgD can sense endogenous antigens, just less efficiently than IgM. Consistent with this conclusion, both HEL-specific IgM and IgD BCRs can mediate B cell anergy and drive a common gene expression program in response to chronic high affinity soluble antigen exposure in vivo Brink et al. Here we show that B cells expressing IgD BCR alone inefficiently sense endogenous antigens, and exhibit impaired in vivo cell fate decisions that are dependent upon BCR signal strength.


This is epitomized by dramatic skewing of IgD-only B cells away from the B1a and towards the MZ fate in a competitive setting. We propose that this impaired sensing is conferred by structural properties of IgD, either through direct binding of antigen and signal transduction through the BCR or through differential pairing with co-receptors that directly modulate the BCR signaling pathway.


Characterization of bona fide endogenous antigens that drive NureGFP expression in the polyclonal repertoire is necessary in order to further dissect the biophysical basis for reduced antigen sensing by IgD in vivo.


These antigens may not be exclusively restricted to those that are germline-encoded or generated by host enzymes; rather they may include non-inflammatory antigens taken up through the gastrointestinal tract and recognized by specific BCRs. We propose that relevant endogenous antigens are presented in contexts that do not efficiently trigger signaling through the flexible structure of IgD.


This might explain the discrepancy between weak responsiveness of IgD to endogenous antigens in vivo and strong signaling in response to crosslinking antibodies in vitro. An alternative mechanism is that differential clustering of co-receptors with IgD and IgM might influence how BCR signals are integrated in vivo.


It has long been proposed that there are not only quantitative, but also qualitative differences between IgM and IgD signaling.


Early studies of IgM and IgD signaling in cell lines suggested that kinetics but not quality of signaling triggered by each isotype differed Kim and Reth, It is possible that differential association with such co-receptors contributes to differences in the function of the IgM and IgD BCRs in vivo by modulating BCR signal strength, or by selectively perturbing specific downstream signaling events.


In addition to B cell co-receptors that have long been known to directly modulate canonical BCR signaling, a growing list of immunoreceptors expressed on B cells have more recently been shown to require expression of the BCR for optimal function; Becker et al. Nor would it account for skewed cell fate decisions by IgD-only B cells in competition with wild type B cells, both of which retain intact CXCR4 signaling.


We control for this effect by confirming that all phenotypes in this study are cell-intrinsic and independent of secreted IgM. This is thought to be transcriptionally mediated at least in part by loss of Ets1 expression and induction of Irf4 in a BCR signal-strength dependent manner Nutt et al. Instead, we provide evidence to suggest that reduced antigen-dependent BCR signals are transduced in vivo by IgD. This suggests that robust Btk-dependent Ets-1 downregulation in response to endogenous antigens relies upon efficient antigen sensing by the IgM BCR and is important to drive unswitched PC expansion in the absence of Lyn.


We propose that the purpose and consequence of IgM downregulation on autoreactive B cells is to limit their direct differentiation into SLPCs in response to chronic endogenous antigen stimulation, and prevent secretion of auto-antibodies in the context of an acute humoral immune response Figure 7—figure supplement 2A. However, IgD is sufficient to drive germinal center differentiation without the contribution of IgM.


This has been well-demonstrated both in the present study as well as prior work Lutz et al. Indeed, not only are autoreactive IgD hi IgM lo B cells competent to enter the germinal center, they appear to do so with greater efficiency, perhaps due in part to improved survival Sabouri et al.


It is worth emphasizing that selection pressures and tolerance mechanisms operating within the germinal center must independently ensure that somatic hypermutation both abolishes germ-line-encoded autoreactivity and prevents de novo acquisition of autoreactivity.


Why, though, are autoreactive B cells preserved in the periphery and not deleted? Why is IgD necessary at all? This is consistent with a well-appreciated pro-survival function of the BCR as demonstrated by Rajewsky and colleagues Kraus et al. IgD expression on IgM lo cells could serve to mediate antigen capture and participation in T-dependent immune responses, while simultaneously limiting SLPC responses as we show here.


We propose that this property of the IgD BCR limits generation of auto-reactive antibodies in the context of immediate humoral immune responses. Hassan Jumaa Lutz et al. Mice were used at 5—12 weeks of age for all functional and biochemical experiments unless otherwise noted. All GF mice were housed in closed caging systems and provided with standard irradiated chow diet, acidified water and housed under a 12 hr light cycle; 7-week-old males mice were used.


GF and control mice were generously provided by Drs. LPS Cat. L was from Sigma. Cells were stained with indicated antibodies and analyzed on a Fortessa Becton Dickson as previously described Hermiston et al.


Data analysis was performed using FlowJo v9. Figures were prepared using Illustrator CS6 v We define biological replicates as independent analyses of cells isolated from different mice of the same genotype, and we define technical replicates as analyses of cells isolated from the same mouse and used in the same experiment. When technical replicates were used, we averaged them to calculate a value for the biological replicate. Wherever MFIs are directly compared, we collected all samples in a single experiment to avoid potential error that could arise from fluctuations in our flow cytometers.


In some instances, MFI ratios were compiled from different experiments for statistical purposes, but qualitative findings were consistent experiment to experiment. As our panels reproducibly generated flow plots with well-defined populations, population sizes were calculated from data compiled from different experiments.


We used paired difference t tests when studying parameters in allotype-heterozygous mice that are sensitive to cell-extrinsic factors e. When comparing three genotypes e. Cells were rested at 37 C for 2 min, and Indo-1 fluorescence was measured immediately prior to stimulation to calculate basal calcium, and for at least two minutes following addition of stimulus.


Splenocytes or lymphocytes were harvested into single cell suspension, subjected to red cell lysis using ACK buffer, and plated at a concentration of 7. Absorbance was measured at nm. Quantifications were performed using Image Lab v. Mice were immunized i. Mice were sacrificed 5 days after immunization, and serum and spleens were harvested.


NP-RSA immunized mice were sacrificed 7—8 days following immunization, and serum and spleens were harvested. To ensure that our calculated values accurately reflect the magnitude and variability of immune responses induced by immunization, we analyzed all mice that had larger plasma cell and germinal center compartments than unimmunized mice.


Nr4a1 forward: gcctagcactgccaaattg; reverse: ggaaccagagagcaagtcat and GAPDH forward: aggtcggtgtgaacggatttg; reverse: tgtagaccatgtagttgaggtca primers were used at nM each. In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included.


The first decision letter after peer review is shown below. Thank you for submitting your work entitled "Differential sensing of endogenous antigens and control of B cell fate by IgM and IgD B cell receptors" for consideration by eLife. Your article has been reviewed by two peer reviewers, and the evaluation has been overseen by a Reviewing Editor and a Senior Editor.


The reviewers have opted to remain anonymous. Our decision has been reached after consultation between the reviewers. As we feel the additional work needed to address the issues raised by the reviewers would take more than two months to complete, we are returning your submission to you now in case you wish to submit elsewhere for speedy publication. If you have a bunch of E. This is a reasonable and accurate expectation. It is also reasonable to expect that different species would have antigens unique to each species but that if the species were related they should have certain antigens in common.


What is surprising is that that sometimes totally unrelated organisms have antigens or epitopes in common. Thus, Epstein-Barr virus has an antigen in common with horse red blood cells and sheep red blood cells.


Consequently, an EB virus infection will cause the patient to make antibodies which react with these RBC's. This situation led to a simple test useful in diagnosing EB virus infections the monospot test for mononucleosis -- patient serum is mixed with a suspension of horse RBC's and agglutination indicates that the patient has made antibodies to EB virus the patient has been infected. Positive monospots are often confirmed by running tests for these antibodies. Such antigens found on unrelated organisms are called heterophile antigens and the antibodies made against them are called heterophile antibodies or heterophile agglutinins.


This can also be called a cross-reaction and these would be cross-reacting antigens and cross-reacting antibodies. Another rather famous example of such cross-reactions is between the M-protein of Streptococcus pyogenes and human heart muscle.


In this case these cross-reacting antibodies may cause the development of rheumatic heart disease. There are 5 major classes of antibodies in humans and these all have the same basic molecular organization:.


Note that each chain has a variable region V-region and a constant region C-region. The V-regions of an H and L chain come together to form an antigen binding site. There are two such binding sites on an antibody monomer. The two binding sites on one antibody molecule are identical to each other since the two L-chains and the two H-chains in one molecule are identical to each other.