Which strand of mrna would be made during
Large stretches of DNA in the human genome are transcribed but do not code for proteins. The nucleotide sequence of the human genome is now known to a reasonable degree of accuracy but we do not yet understand why so much of it is non-coding. Some of this non-coding DNA controls gene expression but the purpose of much of it is not yet understood.
This is a fascinating subject that is certain to advance rapidly over the next few years. Each time a cell divides, each of its double strands of DNA splits into two single strands.
Each of these single strands acts as a template for a new strand of complementary DNA. As a result, each new cell has its own complete genome.
This process is known as DNA replication. Replication is controlled by the Watson-Crick pairing of the bases in the template strand with incoming deoxynucleoside triphosphates, and is directed by DNA polymerase enzymes. It is a complex process, particularly in eukaryotes, involving an array of enzymes. A simplified version of bacterial DNA replication is described in Figure 2. DNA biosynthesis proceeds in the 5'- to 3'-direction. This makes it impossible for DNA polymerases to synthesize both strands simultaneously.
A portion of the double helix must first unwind, and this is mediated by helicase enzymes. The leading strand is synthesized continuously but the opposite strand is copied in short bursts of about bases, as the lagging strand template becomes available. The resulting short strands are called Okazaki fragments after their discoverers, Reiji and Tsuneko Okazaki. Strangely, DNA polymerases cannot initiate DNA synthesis de novo , but require a short primer with a free 3'-hydroxyl group.
Pol III can then take over, but it eventually encounters one of the previously synthesized short RNA fragments in its path. The gap is filled by DNA ligase, an enzyme that makes a covalent bond between a 5'-phosphate and a 3'-hydroxyl group Figure 3. The initiation of DNA replication at the leading strand is more complex and is discussed in detail in more specialized texts.
DNA replication is not perfect. This leads to mismatched base pairs, or mispairs. DNA polymerases have proofreading activity, and a DNA repair enzymes have evolved to correct these mistakes.
Occasionally, mispairs survive and are incorporated into the genome in the next round of replication. These mutations may have no consequence, they may result in the death of the organism, they may result in a genetic disease or cancer; or they may give the organism a competitive advantage over its neighbours, which leads to evolution by natural selection. Transcription is the process by which DNA is copied transcribed to mRNA, which carries the information needed for protein synthesis.
Which of these shows the correct complementary strand of DNA that would be made during DNA replication based on this template strand? What step happens first during DNA transcription? What is the possible effects of an error during transcription? What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg?
What would be the mrna base sequence formed during the transcription using the DNA sequence shown above tag cat ggc at? People also asked. How are bacteria different from viruses? View results.
Study Guides. Trending Questions. Which algebraic expression represents this word description: the quotients of four and the sum of a number and three?
Which of the following happens when a cell divides by mitosis? Still have questions? Find more answers. Previously Viewed. Which strand of mrna would be made during transcription using the DNA strand agc gct?
Unanswered Questions. What characteristics of a tragic hero does Macbeth possess and banquo lack? What could result if a 30 year old lawyer continued to eat as he did as a 17 years old football player? What is the function of resorcinol in the seliwanoff's test? How do you maximally develop the intelligence quotient of a child?
Get the Answers App. All Rights Reserved. Then, a sequence of adenine nucleotides called a poly-A tail is added to the 3' end of the mRNA molecule Figure 7. This sequence signals to the cell that the mRNA molecule is ready to leave the nucleus and enter the cytoplasm. What's next for the RNA molecule? More on transcription. How are polymerases different in prokaryotes and eukaryotes? How is bacterial transcription unique? How is transcription regulated? Once an mRNA molecule is complete, that molecule can go on to play a key role in the process known as translation.
During translation , the information that is contained within the mRNA is used to direct the creation of a protein molecule. In order for this to occur, however, the mRNA itself must be read by a special, protein-synthesizing structure within the cell known as a ribosome.
Watch this video for a summary of eukaryotic transcription. What are introns and exons? Key Concepts RNA replication transcription. Topic rooms within Genetics Close. No topic rooms are there. Browse Visually. Other Topic Rooms Genetics. Student Voices. Creature Cast. Simply Science. Green Screen. Green Science. Bio 2. The Success Code. Why Science Matters. The Beyond. Plant ChemCast. Postcards from the Universe. Brain Metrics. Mind Read.