Ameba Ownd

アプリで簡単、無料ホームページ作成

How does rnase inhibitor work

2022.01.11 16:06




















JavaScript seems to be disabled in your browser. You must have JavaScript enabled in your browser to utilize the functionality of this website. How can we help you today? Email us at sales sciencellonline. Need help with scientific inquiries, technical assistance, product applications, and use? Email us at techsupport sciencellonline. Need help with issues concerning this website? Email us at webmaster sciencellonline. Have any marketing related inquiries? Email us at marketing sciencellonline.


Need help ordering from abroad? As the largest cell provider, we are available worldwide. Please visit our Distributors page to select the company nearest to your location.


Call us at or Interestingly, if the yields between cytoplasmic and periplasmic cultures are compared, it is remarkable that the amounts of soluble RI were highly similar to cytoplasmic yields in the best periplasmic production constructs.


Surprisingly, the RI actvity was even 3-fold higher with the cytoplasmic systems under comparable conditions. After the optimal conditions for periplasmic and cytoplasmic RI production were defined, the next challenge was to test the effect of DTT on product accumulation and folding in the bioreactor under fed-batch conditions. Prior to the fed-batch bioreactor experiments the RI periplasmic and cytoplasmic production with 12 mM DTT in the medium were evaluated under fed-batch conditions in shake flasks by applying the EnBase technology.


Under substrate limited conditions the dsbA - strain grew very poorly and no product could be detected. Left gel: E. Lanes: 1 - total protein fraction 10 min before induction, 2 to 4 - soluble, total, and insoluble protein fractions 4 h after induction with 12 mM of DTT. Data originate from three experiments. Finally, batch and fed-batch periplasmic and cytoplasmic production of RI was performed in a stirred bioreactor. In all fed-batch processes RI production was induced during the glucose-limited growth phase with exponential feeding at an OD of app.


Growth curves of E. For conditions see Material and Methods. Black symbols: control culture without induction; red symbols: batch bioreactor cultivation, blue symbols: fed-batch bioreactor cultivation. DTT is inactivated during bioreactor cultivation with a faster rate compared to shake flask cultures where the DTT oxidation rate was very low Figure 8. Therefore different approaches were tested and compared to keep the reduced state in the culture: i Single pulse addition of DTT to a final concentration of 12 mM at the induction point, ii single pulse addition of DTT to a final concentration of 12 mM 2 h after RI induction, and iii repeated 3 times addition of DTT, starting at 2 h after induction Figure 7.


The amount of reduced DTT during batch shake flask and fed-batch bioreactor processes with microarerobic production mode, was measured by using Measure-iTTM Kit Invitrogen. The data is derived from three assays.


Additionally, in order to prevent rapid DTT oxidization in all processes at the DTT addition point, the air flow was reduced from 30 L min -1 to 2 to 3 L min -1 to maintain the oxygen concentration in the medium close to zero. The reduction of the air flow was a necessary condition for accumulation of active product.


Only at an reduced air flow rate the additon of DTT provoked a clear positive effect with highest yields, and interestingly this worked for both, the periplasmic and the cytoplasmic expression systems. RI activities in the total soluble protein fraction white bars and in the periplasmic fraction grey bars of E. Data derive from three activity assays. Protein activity analysis in the crude extracts of samples from the fed-batch cultures revealed - different from the shake flasks - that RI activity was only improved by 1.


In this work, for the first time, low molecular weight SH group modifying agents were utilized for periplasmic and cytoplasmic folding improvement of a cysteine-rich LRR model protein with exclusively reduced cysteins, a recombinant ribonuclease inhibitor RI. We demonstrated the effect of SH group modifying agents on periplasmic and cytoplasmic activities of RI and its soluble accumulation.


We also showed that the reason for the non-successful approaches for expression of active RI in E. In addition, obviously RI folding in vivo does not just depend on the redox conditions. Only the combination of lower translation rate, low post-induction temperature and strongly reducing conditions resulted in a reasonable yield of RI and these conditions could be applied for periplasmic as well as for cytoplasmic RI production.


Furthermore, on the basis of these principles, which were evaluated in small-scale cultures, production of RI was also successful during fed-batch cultivation in a stirred tank bioreactor. In the first part of the work, for evaluation of significance of keeping reduced conditions, RI folding was compared by expressing RI in the periplasmic compartment of the E.


This approach was based on the well known fact that the redox status in the periplasm could be easily controlled by the addition of SH group stabilizing agents, such as DTT and GSH, to the cultivation medium. However, previous approaches mostly aimed for optimising the redox conditions for disulfide bond isomerisation e.


As a first step, however, we tested whether different combinations of promoter, ribosome binding site and signal sequences stipulate soluble RI accumulation in periplasmic space as a kind of initial standard conditions. Therefore we applied a previously published plasmid library for periplasmic production together with a periplasmic folding reporter system [ 16 ].


In our case the weaker expression elements harbouring periplasmic production constructs gave higher luminescence signals compared to the strong pCTUT7 constructs. We suggest that in case of very poor product solubility, and thus high luminescence signals already in the weaker expression vectors, lower luminescence in the stronger expression vectors is a result of lower luciferase production by an overloaded cellular production machinery.


Accordingly, the strongest growth inhibitory effect was observed for the pCTUT7 constructs in which the expression of luciferase was lowest.


Weaker expression stipulating constructs promoters pC-, pCU-, RBS: -lac, -var resulted in high luminescence signals during periplasmic RI production because a part of the product was found in periplasmic inclusion bodies on one side, but on the other side the weaker target protein expression in these vectors did not consume all cellular recourses needed for luciferase production and cellular growth. Thus in summary, luciferase signals in combination with the periplasmic library have to be evaluated with caution.


As the initial screening results provided no clear answer on the preferable constructs, both, a strong and a weaker expression construct were selected for the further studies.


As the previous results [ 8 ] indicated aggregation in the cytoplasm as a major problem, the following work was focussed on the control of the redox conditions. This was parallel approached by using a dsbA - mutant to remove of the strong oxidising activity of DsbA, and in parallel applying reducing agents.


However, in contrast DTT worked well. More favourable conditions for RI folding in the periplasmic space were created in the dsbA - mutant, but this mutant seemed also to be highly sensitive to DTT and could not be productive in the presence of higher concentrations than 6 mM DTT. By considering all results of the separate analysis of the amounts of processed i. The significance of the synthesis rate of RI for its periplasmic accumulation and folding was clearly demonstrated from RI periplasmic production experiments with DTT in the strong and weak expression stipulating constructs groups.


The results showed that DTT was highly effective only in weaker expression rate stipulating constructs, the balance between the synthesis and the folding rate is important for obtaining soluble product. In contrast DTT was not effective for RI folding in the strong expression elements harbouring constructs in which obviously the RI synthesis rates were too high. The leader peptide had a lower impact on the accumulation of processed RI.


Our results are in good agreement with other periplasmic production cases. For example the significance of synthesis rate on periplasmic accumulation and aggregation of recombinant penicillin G acylase was also demonstrated by Sriubolmas et al.


The authors showed that the cytoplasmic and periplasmic aggregation of penicillin G acylase depend on the synthesis rate, which was altered by varying the amounts of IPTG. In addition, RI accumulation patterns, obtained after RI synthesis with DTT, represented by premature and processed RI forms in the insoluble and soluble protein fractions, are typical for periplasmic production.


Similar pattern were reported by Sriubolmas et al. In both cases a mixture of precursor polypeptides with signal peptides and processed periplasmic proenzyme forms was detected. Finally, another interesting optimisation case may be mentioned, involving the same vector library and the periplasmic misfolding reporter.


Indeed, lower periplasmic aggregation levels and more efficient export to the periplasmic space were observed for the constructs with the weaker pCU promoter and the lac ribosome binding site, compared to the strong expression pCUT7 vectors. Additionally, besides DTT, cytoplasmic folding of RI strongly depended on the production temperature as a synthesis rate and folding regulating factor.


Even when RI production was carried from a weaker promoter and ribosome binding site, the lower production temperature stipulated a better RI folding. Without doubt DTT could also have a negative impact on the overall target protein yield due to the highly induced stress related proteins as reported by Han et al.


Gill et al. Surprisingly our strain demonstrated a comparably high tolerance to DTT. It was still very productive in the medium containing a total DTT concentration of close to 20 mM which according to Missiakas et al. Interestingly, DTT served as an SH group modifier in vivo not just in the periplasmic space but also in the cytoplasm.


It was obvious from the cytoplasmic production results that the redox environment in the E. The E. That would possibly lead to target protein SH group oxidation. Enbase experiments provided valuable information for the process development in the bioreactor. The dsbA - strain turned out to be inable to maintain its productivity under substrate limited feed conditions with DTT and thus would not be favorable for futher bioprocess development. Thus Enbase clearly helped to save time and labor in hte process develpment process.


The bioreactor experiments showed that highly aerated cultivation medium could be a very oxidative environment. Microaerobic or fully anaerobic production strategies would preserve more oxidation sensitive chemicals. On the over hand respiration is a key factor for recombinant productivity. Anaerobic conditions generally result in poor growth and are often considered as unfavourable for recombinant protein production, by limited energy production, acidification of the cytoplasm by organic acids and the large synthetic requirements which are needed to establish the anaerobic responses [ 17 , 24 , 25 ].


Accordingly, we did not succeed to produce RI when the air flow was downregulated at the induction point, however, we could solve the problem by later addition of DTT and concomittant reduction of the airflow.


In our case DTT oxidation in the bioreactor was the main concern during development of the bioreactor process. Thus we created conditions which are usually present in shake flasks [ 17 ]. This down-regulation of the air flow rate had a drastic effect on the cell productivity when it was performed at the same time with DTT addition and RI synthesis induction.


In this case no RI production was found in periplasmic and cytoplasmic constructs. In our opinion the combination of temperature reduction, induction and DTT addition stipulated a huge metabolic burden as earlier defined by Glick [ 26 ]. In order to reduce the stress, we decided to induce recombinant production separately from medium supplementation with DTT and down-regulation of the air flow.


Thus only the temperature shift was performed at the time of induction, but the reducing agent was added only 2 hours after induction when the RI production reached its maximum, and at the same time the air flow was reduced. Furthermore, unexpectedly, after single medium supplementation with DTT much lower RI activity per cell unit was detected in the bioreactor production process compared to the shake flasks.


However, the total RI production level per cell unit in the bioreactor was similar to the shake flask results. We suspected that the decreased RI activity in the bioreactor could be related to the partial oxidation of the DTT even at the very low air flow rate, as confirmed by the analysis of the DTT oxidation rate.


As expected, repeated DTT addition strongly enhanced RI folding during batch and fed-batch processes. In this case the amount of active RI per cell unit in the bioreactor processes was similar to the activities which were detected in samples from shake flasks.


The effective RI production with DTT under batch and fed-batch conditions shows that the in vivo approach for RI folding is reproducible, independently from the cultivation mode and cell densities.


In this study we demonstrate the successful production of active RI by periplasmic and cytoplasmic approaches based on the artificial control of the redox conditions and the expression rate via external manipulations with medium components and cultivation parameters. The folding approach presented here could be very useful for recombinant protein production not just distinguished by reduced SH groups but also for disulfide bond containing proteins. Our folding approach could be applied as an alternative for protein synthesis in the periplasmic compartment where the main synthesis bottleneck is protein transfer across the periplasmic membrane.


The expression strain E. RV plt1 was co-transformed with the library of 36 the RI gene containing periplasmic expression vectors. The dsbA gene in RV was in inactivated by P1 transduction. In addition, the mutation in selected clones was confirmed by PCR analysis, with the following forward and reverse primers: 5'-aagatttggctggcgctggct-3' and 5' - tcggacagatatttcactgtatca - 3.


Transformations and plasmid propagations were performed on solid and liquid LB medium containing Bacto-Tryptone 10 g L -1 , Bacto-yeast extract 5 g L -1 , NaCl 10 g L -1 , 15 g L -1 bacto agar if solid medium and the required antibiotics.


The feeding solution for fed-batch cultivations was based on fully formulated MSM with the required antibiotics and g L -1 of glucose. The OD measurements and the luminometric assay for assaying the target protein periplasmic misfolding levels in MWP's were performed as earlier described [ 8 ].


DTT was added to the cultivation medium at the RI induction point as dry powder to achieve the needed concentration of 2 to18 mM, and reduced glutathione was added with a final concentration of 20 or 50 mM, respectively. The fed-batch shake flask cultivations were performed with the gel-based EnBase system in 1 L baffled Erlenmeyer flasks with mL of MSM medium as earlier described [ 8 ].


Glucose release for substrate limited growth was generated by 12 AGU L -1 in the cultivation medium. RNases generally have a very high specific activity towards their substrate RNA. Incidentally, this is also one of the reasons that an RNase RNase A was the first enzyme to have its mechanism of catalysis deduced Findlay et al Convential wisdom says that if you autoclave RNases, they denature, but then renature and re-gain partial function after cooling.


This amazing, fabled fortitude is enabled by a series of intramolecular disulfide bonds that keep the structure intact, even after the hydrogen bonds that normally hold the 3D protein structure in place are broken. Like all fables, this is true to an extent. But read on and we will find out that this particular super-power has been hyped up by the spin doctors at RNase Baddies Inc. Unlike other nucleases, many RNases do not require metal ions for catalysis since they use the 2-prime hydroxyl group of the RNA substrate as a reactive species So simply adding TE does not inhibit them, like it would for DNA-munching nucleases.


Do not fret, fellow scientist. RNases may be formidable enemies, but they have weaknesses that we can exploit. RNases rely on histidine residues in their active site for catalysis. So diethyl pyrocarbonate DEPC , which is a histidine-specific alkylating agent, can inactivate them.


Autoclaving will then remove the DEPC to stop it from alkalyating any other proteins in you, or your samples. The much fabled indestructibility of RNases in the face of autoclaving is true at the core, but also very over-hyped, as I mentioned above. Rather their activity is decimated by autoclaving, but a small portion of the RNase activity remains after autoclaving. Dry heat oxidises RNAses — any any other protein, no matter how robust their are. So for cleaning your glassware, a couple of hours at degC should do it.


These are all commonly used to get rid of even the toughest RNases.